@article{eddb9abb39414d57885d78ee39f1f8a2,
title = "The anti‑epithelial cell adhesion molecule (EpCAM) monoclonal antibody EpMab‑16 exerts antitumor activity in a mouse model of colorectal adenocarcinoma",
abstract = "The epithelial cell adhesion molecule (EpCAM), which is a calcium‑independent homophilic intercellular adhesion factor, contributes to cell signaling, differentiation, proliferation and migration. EpCAM is essential for carcino‑ genesis in numerous types of human cancer. The purpose of the present study was to establish an anti‑EpCAM monoclonal antibody (mAb) for targeting colorectal adenocarcinomas. Thus, an anti‑EpCAM mAb, EpMab‑16 (IgG2a, κ), was estab‑ lished by immunizing mice with EpCAM‑overexpressing CHO‑K1 cells, and validated using flow cytometry, western blot, and immunohistochemical analyses. EpMab‑16 reacted with endogenous EpCAM specifically in a colorectal adeno‑ carcinoma cell line as determined by flow cytometry and western blot analyses. Immunohistochemical analysis demon‑ strated that EpMab‑16 stained a plasma membrane‑like pattern in clinical colorectal adenocarcinoma tissues. The dissociation constant (KD) for EpMab‑16 in a Caco‑2 colorectal adenocarci‑ noma cell line determined by flow cytometry was 1.8x10‑8 M, suggesting moderate binding affinity of EpMab‑16 for EpCAM. Whether the EpMab‑16 induced antibody‑dependent cellular cytotoxicity (ADCC) and complement‑dependent cytotoxicity (CDC) against Caco‑2 or antitumor activity was then assessed in a murine xenograft model. In vitro experiments revealed strong ADCC and CDC induction in Caco‑2 cells by EpMab‑16 treatment. In vivo experiments in a Caco‑2 xenograft model demonstrated that EpMab‑16 treatment significantly reduced tumor growth compared with that in mice treated with the control mouse IgG. These results suggested that EpMab‑16 may be a promising treatment option for EpCAM‑expressing colorectal adenocarcinomas.",
keywords = "ADCC, Antitumor activity, CDC, Colorectal adenocarcinoma, EpCAM, Monoclonal antibody",
author = "Hideki Hosono and Tomokazu Ohishi and Junko Takei and Teizo Asano and Yusuke Sayama and Manabu Kawada and Kaneko, {Mika K.} and Yukinari Kato",
note = "Funding Information: This research was supported in part by the Japan Agency for Medical Research and Development (grant nos. JP20am0401013 to YK, JP20am0101078 to YK and JP20ae0101028 to YK). Funding Information: The authors would like to thank Mr. Takuro Nakamura, Ms. Miyuki Yanaka, Ms. Saori Handa, Ms. Saki Okamoto and Mr. Yu Komatsu (Department of Antibody Drug Development, Tohoku University Graduate School of Medicine, Sendai, Japan) for technical assistance with the in vitro experiments, and Ms. Akiko Harakawa [Institute of Microbial Chemistry (BIKAKEN), Microbial Chemistry Research Foundation, Numazu, Japan] for technical assistance with the animal experiments. This research was supported in part by the Japan Agency for Medical Research and Development (grant nos. JP20am0401013 to YK, JP20am0101078 to YK and JP20ae0101028 to YK). Funding Information: Cell lines. P3X63Ag8U.1 (P3U1), CHO‑K1 and Caco‑2 cells were obtained from the American Type Culture Collection. The Genome Network Project clone IRAK021G03 (EpCAM) was provided by the RIKEN BioResource Research Center through the National BioResource Project of the MEXT and AMED agencies of Japan (18‑21). EpCAM DNA plus a C‑terminal PA tag recognized by the anti‑PA tag mAb (NZ‑1) was subcloned into a pCAG‑Ble vector (FUJIFILM Wako Pure Chemical Corporation). CHO/EpCAM was established by transfecting pCAG/EpCAM‑PA into CHO‑K1 cells using the Neon Transfection System (Thermo Fisher Scientific, Inc.). CHO‑K1 cells (1.5x106) were transfected with 10 µg of plasmid DNA using 100 µl Neon tip, at room temperature. After 4 days, cells were incubated with 1 µg/ml anti‑EpCAM mAb (clone 9C4; cat. no. 324202; BioLegend, Inc.) for 30 min on ice and subsequently with Alexa Fluor 488‑conjugated anti‑mouse IgG (1:1,000; cat. no. 4408; Cell Signaling Technology, Inc.) for 30 min on ice. Positive cells for anti‑EpCAM mAb were sorted using an SH800 cell sorter (Sony Corporation), and stable transfectants were cultivated in RPMI‑1640 medium (Nacalai Tesque, Inc.) containing 0.5 mg/ml zeocin (InvivoGen). Using TruGuide gRNA tool, gRNA of EpCAM (NM_002354) was selected from GeneArt predesigned gRNAs database (Thermo Fisher Scientific, Inc.). gRNA sequence used was GATCCTGACTGCGATGAGAG(cgg), which targeted exon 3 of EpCAM (Assay ID, CRISPR701274). Double strand gRNA sequence was subcloned into GeneArt CRISPR Nuclease Vector with OFP Reporter (Thermo Fisher Scientific, Inc.). Caco‑2/EpCAM‑knockout (BINDS‑16) cells were generated by transfecting 10 μg of CRISPR/Cas9 plasmids for EpCAM (Thermo Fisher Scientific, Inc.) into Caco‑2 cells (1.5x106) for 7 days using a Neon transfection system with 100 µl Neon tip. Stable transfectants were established by cell sorting as aforementioned. P3U1, CHO‑K1 and CHO/EpCAM cells were cultured in RPMI‑1640 medium (Nacalai Tesque, Inc.). Caco‑2 and BINDS‑16 were cultured in Dulbecco's modified Eagle's medium (DMEM; Nacalai Tesque, Inc.). The medium was supplemented with 10% heat‑inactivated fetal bovine serum (FBS; Thermo Fisher Scientific Inc.), 100 U/ml peni‑ cillin, 100 µg/ml streptomycin and 0.25 µg/ml amphotericin B (Nacalai Tesque, Inc.), and the cells were incubated at 37˚C in a humidified atmosphere containing 5% CO2. Publisher Copyright: {\textcopyright} 2020 Spandidos Publications. All rights reserved.",
year = "2020",
month = dec,
doi = "10.3892/ol.2020.12246",
language = "English",
volume = "20",
journal = "Oncology Letters",
issn = "1792-1074",
publisher = "Spandidos Publications",
number = "6",
}
