Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)

Jun Xu, Nobuo Koizumi, Shuichi Nakamura

Research output: Contribution to journalComment/debatepeer-review

Abstract

In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).

Original languageEnglish
Article number736406
JournalFrontiers in Microbiology
Volume12
DOIs
Publication statusPublished - 2021 Aug 17

Keywords

  • bacterial motility
  • biophysics
  • host–pathogen association
  • leptospirosis
  • optical microscopy
  • pathogenicity
  • spirochete
  • zoonosis

ASJC Scopus subject areas

  • Microbiology
  • Microbiology (medical)

Fingerprint

Dive into the research topics of 'Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira (Frontiers in Microbiology, (2020), 11, (1886), 10.3389/fmicb.2020.01886)'. Together they form a unique fingerprint.

Cite this