Abstract
In the original article, there was a mistake in Supplementary Table S1 as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCA TCCATG” is correct. The corrected Supplementary Table S1 appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. (Table presented.).
Original language | English |
---|---|
Article number | 736406 |
Journal | Frontiers in Microbiology |
Volume | 12 |
DOIs |
|
Publication status | Published - 2021 Aug 17 |
Keywords
- bacterial motility
- biophysics
- host–pathogen association
- leptospirosis
- optical microscopy
- pathogenicity
- spirochete
- zoonosis
ASJC Scopus subject areas
- Microbiology
- Microbiology (medical)